Emergence and Expansion of a Carbapenem-Resistant Pseudomonas aeruginosa Clone Are Associated with Plasmid-Borne bla KPC-2 and Virulence-Related Genes

Emergence and Expansion of a Carbapenem-Resistant Pseudomonas aeruginosa Clone Are Associated with Plasmid-Borne bla KPC-2 and Virulence-Related Genes

beads
Pseudomonas aeruginosa is a serious opportunistic pathogen and one of many main bacterial species inflicting well being care-associated infections. Carbapenems are the simplest antimicrobial brokers for the remedy of extreme infections attributable to P. aeruginosa Nevertheless, our current surveillance demonstrated that the prevalence of carbapenem-resistant P. aeruginosa (CRPA) reached 38.67% in Zhejiang, China.
By analyzing CRPA isolates collected from sufferers from 2006 to 2018, we discovered that 33% of CRPA isolates carried the gene bla KPC-2, which conferred high-level resistance to carbapenems and different β-lactams. Particularly, a CRPA clone, ST463 (sequence sort 463), emerged and has turn out to be the predominant CRPA clone among the many inhabitants. Genome sequencing demonstrated that ST463 enlargement was related to plasmid-borne bla KPC-2 The cellular factor flanking bla KPC-2, the kind IV secretion system, and the profitable enlargement of clone ST463 might need additional favored bla KPC-2 unfold in P. aeruginosa Molecular clock evaluation dated the emergence of clone ST463 to round 2007.
Genome-wide affiliation evaluation confirmed that 567 genes have been related to clone ST463, together with a number of identified virulence genes associated to the biosynthesis of lipooligosaccharide (LOS) O-antigens and exotoxin. These findings point out that ST463 is increasing with plasmid-borne bla KPC-2 and virulence-related genes in nosocomial infections, and shut surveillance ought to be undertaken sooner or later.
IMPORTANCE Well being care-associated infections, often known as nosocomial infections, are essentially the most frequent hostile occasions in well being care supply worldwide, inflicting excessive charges of morbidity and mortality and excessive well being care prices. Pseudomonas aeruginosa is among the main bacterial species inflicting well being care-associated infections. Carbapenems are the simplest antimicrobial brokers for the remedy of its extreme infections. Nevertheless, the prevalence of carbapenem-resistant P. aeruginosa (CRPA) has been growing quickly in recent times, and our surveillance demonstrated that the prevalence of CRPA reached 38.67% in Zhejiang, China. Genome sequencing of CRPA isolates over a decade confirmed {that a} CRPA clone (ST463) emerged not too long ago.
The clone is extremely proof against β-lactams, together with carbapenems, and fluoroquinolones. Genome-wide affiliation evaluation confirmed that the clone expanded with virulence-related genes and the plasmid-borne carbapenem-resistant gene bla KPC-2 These findings are of great public well being significance, as the data will facilitate the management and minimization of CRPA nosocomial infections.

Full genome sequence of marine Roseobacter lineage member Monaibacterium sp. ALG8 with six plasmids remoted from seawater round brown algae

Monaibacterium sp. ALG8 (=MCCC 1 Okay04733) was remoted from seawater round brown algae. The genome of Monaibacterium sp. ALG8 was sequenced, one round 3,036,380 bp chromosome and 6 round plasmids starting from 12,229 to 151,263 bp have been discovered after meeting. The outcomes of genomic annotation confirmed that Monaibacterium sp. ALG8 lacks the flexibility to degrade alginate, indicating its ecological position might not be immediately associated to the degradation of brown algae.
 Emergence and Expansion of a Carbapenem-Resistant Pseudomonas aeruginosa Clone Are Associated with Plasmid-Borne bla KPC-2 and Virulence-Related Genes
The comparability of genomic options within the plasmids confirmed that the majority of those plasmids, besides pALG4, have been horizontally recruited from donors, not ancestors. Based mostly on predicted capabilities, the existence of plasmids might present pressure ALG8 with benefits together with nitrate discount, tolerance of osmotic stress by way of glycine betaine, resistance to heavy steel stress equivalent to mercury and cobalt, degradation of benzoate metabolites equivalent to p-cumate, transformation of the swim-or-stick life-style and enchancment of the immune system with two CRISPR-Cas methods. This examine gives proof for the carbon metabolic patterns of Monaibacterium sp. ALG8 and predicts the capabilities and donors of six plasmids on this pressure, broadening our understanding of the ecological roles of micro organism within the setting round brown algae and the capabilities and evolutionary patterns of plasmids in marine Roseobacter lineage members.

A high-efficiency methodology for site-directed mutagenesis of huge plasmids primarily based on giant DNA fragment amplification and recombinational ligation

Web site-directed mutagenesis for big plasmids is a troublesome job that can’t simply be solved by the standard strategies utilized in many laboratories. On this examine, we developed an efficient methodology for Web site-directed Mutagenesis for Massive Plasmids (SMLP) primarily based on a PCR approach. The SMLP methodology combines a number of efficient approaches, together with a high-efficiency DNA polymerase for the big DNA amplification, two unbiased PCR reactions and a quick recombinational ligation.

pLenti-CTLA4 shRNA-2 Plasmid

PVTBAV05689-2 2 ug
EUR 356

pLenti-FOXM1 shRNA-2 Plasmid

PVTBAV08732-2 2 ug
EUR 356

pLenti-JUN shRNA-2 Plasmid

PVTBAV11741-2 2 ug
EUR 356

pLenti-LHX6 shRNA-2 Plasmid

PVTBAV12881-2 2 ug
EUR 356

pLenti-MAGEA3 shRNA-2 Plasmid

PVTBAV13661-2 2 ug
EUR 356

pLenti-RUNX3 shRNA-2 Plasmid

PVTBAV20583-2 2 ug
EUR 356

pLenti-Slc7a11 shRNA-2 Plasmid

PVTBAV21973-2 2 ug
EUR 356

pLenti-STAT3 shRNA-2 Plasmid

PVTBAV22921-2 2 ug
EUR 356

pLenti-XRCC5 shRNA-2 Plasmid

PVTBAV26238-2 2 ug
EUR 356

Recombinant HIV-2 Protease Protein, Untagged, E.coli-10ug

QP12271-10ug 10ug
EUR 201

Recombinant Human BMP-2 Protein, Untagged, E.coli-10ug

QP5363-10ug 10ug
EUR 237

Recombinant Porcine IL 2 Protein, Untagged, E.coli-10ug

QP10699-10ug 10ug
EUR 201

Recombinant Canine MCP 2 Protein, Untagged, E.coli-10ug

QP10782-10ug 10ug
EUR 201

Recombinant Human Arginase-2, GST, E.coli-10ug

QP5676-ec-10ug 10ug
EUR 200

Recombinant Human Glutaredoxin-2, GST, E.coli-10ug

QP8154-ec-10ug 10ug
EUR 200

Recombinant Human CXCL2/ MIP-2 Protein, Untagged, E.coli-10ug

QP1016-10ug 10ug
EUR 237

Recombinant Influenza Parainfluenza Type-2 Protein, Untagged, E.coli-10ug

QP12960-10ug 10ug
EUR 155

Recombinant Mouse MCP-2/ CCL8 Protein, Untagged, E.coli-10ug

QP5471-10ug 10ug
EUR 237

Recombinant Human MMP-2 Protein, His, HEK 293-10ug

QP10790-10ug 10ug
EUR 201

Recombinant Human STC 2 Protein, Untagged, HEK 293-10ug

QP13613-10ug 10ug
EUR 201

Recombinant Bovine FGF 2 Protein, Untagged, Native Protein-10ug

QP10599-10ug 10ug
EUR 355

Recombinant Human Semenogelin-2 Protein, His, Yeast-10ug

QP9386-ye-10ug 10ug
EUR 308

Recombinant Human Hyaluronidase-2 Protein, His, Yeast-10ug

QP9753-ye-10ug 10ug
EUR 236

Recombinant Human Ficolin-2 Protein, His, Yeast-10ug

QP9759-ye-10ug 10ug
EUR 236

Recombinant Zebrafish Metallothionein-2 Protein, His, Yeast-10ug

QP9826-ye-10ug 10ug
EUR 362

Recombinant Mouse Arginase-2, His-SUMO, E.coli-10ug

QP5677-ec-10ug 10ug
EUR 272

Recombinant Mouse Bcl-2 Protein, His, E.coli-10ug

QP5710-ec-10ug 10ug
EUR 155

Recombinant Bovine FGF 2 Protein, Untagged, E.coli-10ug

QP10599-EC-10ug 10ug
EUR 155

Recombinant Human Plastin-2 Protein, His, Yeast-10ug

QP6289-ye-10ug 10ug
EUR 236

Recombinant Human Galectin-2 Protein, GST, E.coli-10ug

QP6295-ec-10ug 10ug
EUR 200

Recombinant Human Metaxin-2 Protein, GST, E.coli-10ug

QP6393-ec-10ug 10ug
EUR 272

Recombinant Human Twinfilin-2 Protein, GST, E.coli-10ug

QP7777-ec-10ug 10ug
EUR 200

Recombinant Human Prohibitin-2 Protein, GST, E.coli-10ug

QP8027-ec-10ug 10ug
EUR 200

Recombinant Human Talin-2 Protein, His, Yeast-10ug

QP8291-ye-10ug 10ug
EUR 236

Recombinant Chicken Vitellogenin-2 Protein, His, E.coli-10ug

QP8859-ec-10ug 10ug
EUR 326

Recombinant Mouse Renin-2 Protein, His, E.coli-10ug

QP8886-ec-10ug 10ug
EUR 272

Recombinant Human Metallothionein-2 Protein, GST, E.coli-10ug

QP8894-ec-10ug 10ug
EUR 200

Recombinant E.coli Thioredoxin-2 Protein, His, Yeast-10ug

QP7012-ye-10ug 10ug
EUR 362

Recombinant Mouse Thrombospondin-2 Protein, His, E.coli-10ug

QP6786-ec-10ug 10ug
EUR 272

Recombinant Mouse Thrombospondin-2 Protein, His, Yeast-10ug

QP6786-ye-10ug 10ug
EUR 272

Recombinant Human IGF-2/ IGF-II Protein, Untagged, E.coli-10ug

QP5264-10ug 10ug
EUR 136

Recombinant Dengue Virus Dengue Envelope-2 Protein, Untagged, Insect-10ug

QP11626-10ug 10ug
EUR 201

Recombinant Human CCL24/ Eotaxin-2/ MPIF-2 Protein, His, E.coli-10ug

QP8522-ec-10ug 10ug
EUR 200

Recombinant Human Bcl 2 (minus BH4 domain) Protein, His, E.coli-10ug

QP11138-10ug 10ug
EUR 201

Recombinant Human 2-5A-dependent ribonuclease Protein, His-SUMO, E.coli-10ug

QP6997-10ug 10ug
EUR 155

pDONR223-CD73 Plasmid

PVTB00480-2 2 ug
EUR 356

Recombinant Bovine Serpin A3-2 Protein, His, Yeast-10ug

QP9699-ye-10ug 10ug
EUR 362

Recombinant Human SerpinB2/ PAI-2 Protein, Untagged, E.coli-10ug

QP10161-ec-10ug 10ug
EUR 290

Recombinant Human TIMP2/ TIMP-2 Protein, Untagged, E.coli-10ug

QP10162-ec-10ug 10ug
EUR 290

Recombinant Human CCL8/ MCP-2 Protein, Untagged, E.coli-10ug

QP10231-ec-10ug 10ug
EUR 290

Recombinant Human IL2/ Interleukin-2 Protein, Untagged, E.coli-10ug

QP10309-ec-10ug 10ug
EUR 154

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-10ug

QP10390-ec-10ug 10ug
EUR 154

Recombinant Human CCL8/ MCP-2 Protein, GST, E.coli-10ug

QP4994-ec-10ug 10ug
EUR 200

Recombinant Human CCL8/ MCP-2 Protein, His, Yeast-10ug

QP4994-ye-10ug 10ug
EUR 236

Recombinant Human BMP-2 Protein, Untagged, HEK 293-10ug

QP5363-HEK-10ug 10ug
EUR 218

Recombinant Human Caspase-2 Protein, His-SUMO, E.coli-10ug

QP5762-ec-10ug 10ug
EUR 200

Recombinant Mouse Desmoglein-2 Protein, His-SUMO, E.coli-10ug

QP5947-ec-10ug 10ug
EUR 326

Recombinant Human Elongation factor 2 Protein, His, E.coli-10ug

QP5962-ec-10ug 10ug
EUR 200

Recombinant Human Estrogen Receptor 2 Protein, His, Yeast-10ug

QP6000-ye-10ug 10ug
EUR 236

Recombinant Mouse Hyaluronan synthase 2 Protein, His, E.coli-10ug

QP6144-ec-10ug 10ug
EUR 272

Recombinant Mouse Hyaluronan synthase 2 Protein, His, Yeast-10ug

QP6144-ye-10ug 10ug
EUR 272

Recombinant Human IL2/ Interleukin-2 Protein, GST, E.coli-10ug

QP6216-ec-10ug 10ug
EUR 200

Recombinant Human IL2/ Interleukin-2 Protein, His, Yeast-10ug

QP6216-ye-10ug 10ug
EUR 236

Recombinant Rabbit IL2/ Interleukin-2 Protein, His, E.coli-10ug

QP6218-ec-10ug 10ug
EUR 326

Recombinant Human Integrin alpha-2 Protein, His, Yeast-10ug

QP6238-ye-10ug 10ug
EUR 236

Recombinant Human Plastin-2 Protein, His-SUMO, E.coli-10ug

QP6289-ec-10ug 10ug
EUR 200

Recombinant Human 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug

QP6447-ec-10ug 10ug
EUR 200

Recombinant Rat Neuroendocrine convertase 2 Protein, His, E.coli-10ug

QP6473-ec-10ug 10ug
EUR 326

Recombinant Rat SerpinB2/ PAI-2 Protein, His, Yeast-10ug

QP6669-ye-10ug 10ug
EUR 272

Recombinant Human Septin-2 Protein, His-SUMO, E.coli-10ug

QP7552-ec-10ug 10ug
EUR 272

Recombinant Human Clavesin-2 Protein, His-SUMO, E.coli-10ug

QP7684-ec-10ug 10ug
EUR 200

Recombinant Mouse 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug

QP7717-ec-10ug 10ug
EUR 272

Recombinant Human Sesquipedalian-2 Protein, His-SUMO, E.coli-10ug

QP7760-ec-10ug 10ug
EUR 200

Recombinant Human Complexin-2/ CPLX2 Protein, GST, E.coli-10ug

QP7773-ec-10ug 10ug
EUR 272

Recombinant Human Vasohibin-2 Protein, His-SUMO, E.coli-10ug

QP7784-ec-10ug 10ug
EUR 272

Recombinant Macaque CXCL10/ Crg-2 Protein, His, E.coli-10ug

QP7849-ec-10ug 10ug
EUR 326

Recombinant Human Thioredoxin-2/ TXN2 Protein, GST, E.coli-10ug

QP8009-ec-10ug 10ug
EUR 200

Recombinant Human Calponin-2 Protein, His-SUMO, E.coli-10ug

QP8036-ec-10ug 10ug
EUR 200

Recombinant Human Thioredoxin reductase 2, His-SUMO, E.coli-10ug

QP8200-ec-10ug 10ug
EUR 200

Recombinant Human Talin-2 Protein, His-SUMO, E.coli-10ug

QP8291-ec-10ug 10ug
EUR 200

Recombinant Human Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug

QP8512-ec-10ug 10ug
EUR 200

Recombinant Human TIMP2/ TIMP-2 Protein, GST, E.coli-10ug

QP8571-ec-10ug 10ug
EUR 200

Recombinant Mouse CXCL2/ MIP-2 Protein, His, E.coli-10ug

QP8651-ec-10ug 10ug
EUR 272

Recombinant Human Glutamate carboxypeptidase 2 Protein, His, E.coli-10ug

QP8726-ec-10ug 10ug
EUR 200

Recombinant E.coli GTP cyclohydrolase-2 Protein, His, E.coli-10ug

QP8879-ec-10ug 10ug
EUR 326

Recombinant Mouse Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug

QP8884-ec-10ug 10ug
EUR 272

Recombinant E.coli Thioredoxin-2 Protein, His-SUMO, E.coli-10ug

QP7012-ec-10ug 10ug
EUR 326

Recombinant Human Retinal dehydrogenase 2 Protein, His, Yeast-10ug

QP8968-ye-10ug 10ug
EUR 308

Recombinant Mouse Elongation factor 2 Protein, His, Yeast-10ug

QP9112-ye-10ug 10ug
EUR 272

Recombinant Human MBL-2/ MBL Protein, His, Yeast-10ug

QP9268-ye-10ug 10ug
EUR 236

Recombinant Human Tryptase beta-2 Protein, His, E.coli-10ug

QP6832-ec-10ug 10ug
EUR 200

Recombinant Mouse Tryptase beta-2 Protein, GST, E.coli-10ug

QP6833-ec-10ug 10ug
EUR 272

KRTAP4-2 cloning plasmid

CSB-CL861178HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: ATGGTCAACTCCTGTTGTGGCTCTGTGTGCTCTGACCAGGGCTGTGGCCTAGAGAACTGCTGCCGTCCCAGCTGCTGCCAGACCACCTGCTGCAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCGCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCAC
  • Show more
Description: A cloning plasmid for the KRTAP4-2 gene.

KRTAP3-2 cloning plasmid

CSB-CL871617HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 297
  • Sequence: atggattgctgtgcctctcgcagctgcagtgtccccactgggcctgccaccaccatctgctcctccgacaaatcctgccgctgtggagtctgcctgcccagcacctgcccacacacagtttggttactggagcccatctgctgtgacaactgtcccccaccctgccacattcctca
  • Show more
Description: A cloning plasmid for the KRTAP3-2 gene.

KRTAP9-2 cloning plasmid

CSB-CL880139HU1-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACATGCTGCAGGACCACCTGCTGCAGGACCACCTGCTGGAAGCCCACCACTGTGACCACCTGCAGCAGCACATCCTGCTGCCAGCCCGCCTGCTGTGTGTCCAGCTGCTGCCAGCCTTGCTGCCGCCCAACTTCCTGTCAAAA
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP9-2 cloning plasmid

CSB-CL880139HU2-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: atgacccactgttgctccccttgctgtcagcctacctgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacaccctgctgccagcccgcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttgctgtcaaaa
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP12-2 cloning plasmid

CSB-CL012606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: ATGTGTCATACCAGCTGCTCCTCGGGCTGCCAGCCAGCCTGCTGCGCGCCCAGCCCCTGCCAGCCAGCCTGTTGTGTGCCCAGCTCCTGCCAGGCATCCTGCTGTGTGCCTGTGGGCTGCCAGTCCTCCGTGTGTGTGCCCGTGAGCTTCAAGCCAGCCGTGTGCCTGCCCGTGAG
  • Show more
Description: A cloning plasmid for the KRTAP12-2 gene.

Plasmid Midi Kit I

K1314-2
EUR 262

Plasmid Midi Kit II

K1315-2
EUR 262

Plasmid ezFilter Mega3 Kit

K1320-2
EUR 343

Plasmid ezFilter Mega6 Kit

K1321-2
EUR 370

Plasmid ezFilter Mega10 Kit

K1322-2
EUR 452

pCR4-TOPO-RNF135 Plasmid

PVTB01189-2 2 ug
EUR 356

pGEM-Ltf(Q25R) Plasmid

PVTB50084-2 2 ug
EUR 356

Recombinant Human FKBP6 Protein, His, -10ug

QP10610-10ug 10ug
EUR 201

Recombinant Human Transmembrane protease serine 2 Protein, His, Yeast-10ug

QP9439-ye-10ug 10ug
EUR 272

Recombinant Mouse Protein delta homolog 2 Protein, His, Yeast-10ug

QP9838-ye-10ug 10ug
EUR 308

Recombinant Human IL12RB2/ IL12R-beta 2 Protein, His, Yeast-10ug

QP9881-ye-10ug 10ug
EUR 236

Recombinant Human Ribonucleoprotein PTB-binding 2 Protein, His, Yeast-10ug

QP9902-ye-10ug 10ug
EUR 236

Recombinant Human Growth/ differentiation factor 2 Protein, His, Yeast-10ug

QP9936-ye-10ug 10ug
EUR 236

Recombinant Human Exportin-2 Protein, His-SUMO, Invitro-E.coli-10ug

QP9974-iv-10ug 10ug
EUR 780

Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug

QP10212-ec-10ug 10ug
EUR 290

Recombinant Rat NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug

QP10285-ec-10ug 10ug
EUR 290

Recombinant Human AK2/ Adenylate kinase 2 Protein, GST, E.coli-10ug

QP5635-ec-10ug 10ug
EUR 200

Recombinant Human CALCB/ CGPR/ Calcitonin 2 Protein, GST, E.coli-10ug

QP5747-ec-10ug 10ug
EUR 200

Recombinant Human Calpain-2 catalytic subunit Protein, His, E.coli-10ug

QP5756-ec-10ug 10ug
EUR 200

Recombinant Human CETN2/ Centrin 2 Protein, His-SUMO, E.coli-10ug

QP5820-ec-10ug 10ug
EUR 200

Recombinant Human CFL2/ cofilin 2/ ADF Protein, GST, E.coli-10ug

QP5825-ec-10ug 10ug
EUR 200

Recombinant Human Clathrin heavy chain 2 Protein, His, E.coli-10ug

QP5842-ec-10ug 10ug
EUR 200

Recombinant Human Clathrin heavy chain 2 Protein, His, Yeast-10ug

QP5842-ye-10ug 10ug
EUR 236

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug

QP5968-ec-10ug 10ug
EUR 200

Recombinant Human Glycerol kinase 2 Protein, His-SUMO, E.coli-10ug

QP6085-ec-10ug 10ug
EUR 200

Recombinant Macaque IL2/ Interleukin-2 Protein, His-SUMO, E.coli-10ug

QP6217-ec-10ug 10ug
EUR 326

Recombinant Human Integrin alpha-2 Protein, His-SUMO, E.coli-10ug

QP6238-ec-10ug 10ug
EUR 200

Recombinant Human JAM-2/ JAM-B Protein, His, E.coli-10ug

QP6247-ec-10ug 10ug
EUR 200

Recombinant Human JAM-2/ JAM-B Protein, His, Yeast-10ug

QP6247-ye-10ug 10ug
EUR 236

Recombinant Rat MMP-2/ CLG4A Protein Protein, His, Yeast-10ug

QP6369-ye-10ug 10ug
EUR 272

Recombinant Human Nanos homolog 2 Protein, His-SUMO, E.coli-10ug

QP6402-ec-10ug 10ug
EUR 200

Recombinant Human Nuclear transport factor 2 Protein, GST, E.coli-10ug

QP6442-ec-10ug 10ug
EUR 200

Recombinant Human Phosphomannomutase 2/ PMM2/ CDG1 Protein, GST, E.coli-10ug

QP6508-ec-10ug 10ug
EUR 200

Recombinant Human PTGS2/ COX2/ PGHS-2 Protein, His, E.coli-10ug

QP6551-ec-10ug 10ug
EUR 200

Recombinant Rat SerpinB2/ PAI-2 Protein, His-SUMO, E.coli-10ug

QP6669-ec-10ug 10ug
EUR 272

Recombinant Human Serine palmitoyltransferase 2 Protein, His-SUMO, E.coli-10ug

QP6726-ec-10ug 10ug
EUR 200

Recombinant Mouse Hemoglobin subunit beta-2 Protein, GST, E.coli-10ug

QP7346-ec-10ug 10ug
EUR 272

Recombinant Mouse Hemoglobin subunit beta-2 Protein, His, Yeast-10ug

QP7346-ye-10ug 10ug
EUR 272

Recombinant Human Protein delta homolog 2 Protein, GST, E.coli-10ug

QP7755-ec-10ug 10ug
EUR 200

Recombinant Human Protein delta homolog 2 Protein, His, Yeast-10ug

QP7755-ye-10ug 10ug
EUR 236

Recombinant Human CD112/ Nectin-2/ PVRL2 Protein, His, E.coli-10ug

QP7863-ec-10ug 10ug
EUR 200

Recombinant Human GMP reductase 2 Protein, His-SUMO, E.coli-10ug

QP8126-ec-10ug 10ug
EUR 200

Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, E.coli-10ug

QP8243-ec-10ug 10ug
EUR 200

Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, Yeast-10ug

QP8243-ye-10ug 10ug
EUR 236

Recombinant Human RuvB-like 2 Protein, His-SUMO, E.coli-10ug

QP8295-ec-10ug 10ug
EUR 272

Recombinant Human Glucosidase 2 subunit beta Protein, GST, E.coli-10ug

QP8431-ec-10ug 10ug
EUR 200

Recombinant Human IGF-2/ IGF-II Protein, GST, E.coli-10ug

QP8601-ec-10ug 10ug
EUR 200

Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, GST, E.coli-10ug

QP8641-ec-10ug 10ug
EUR 200

Recombinant Human Laminin subunit beta-2 Protein, His, E.coli-10ug

QP8788-ec-10ug 10ug
EUR 200

Recombinant Rat BDNF Protein Isoform 2 Protein, His, E.coli-10ug

QP8869-ec-10ug 10ug
EUR 272

Recombinant Human Tumor suppressor candidate 2 Protein, GST, E.coli-10ug

QP6856-ec-10ug 10ug
EUR 200

Recombinant Human Orexin receptor type 2 Protein, His, Yeast-10ug

QP9175-ye-10ug 10ug
EUR 308

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-10ug

QP9310-ye-10ug 10ug
EUR 236

Recombinant Human Phosphatidylinositol Transfer Protein α Isoform/PITPNA (N-6His)

CE10-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 1mM EDTA, 1mM DTT, pH 8.0.

ToxOut? Endofree Plasmid Midi Kit

K1328-2
EUR 207

ToxOut? Endofree Plasmid Maxi Kit

K1330-2
EUR 234

ToxOut? Endofree Plasmid Mega3 Kit

K1332-2
EUR 316

ToxOut? Endofree Plasmid Mega6 Kit

K1333-2
EUR 370

ToxOut? Endofree Plasmid Mega10 Kit

K1334-2
EUR 425

pMD19-T-LEO1(E225G) Plasmid

PVTB01141-2 2 ug
EUR 356

Recombinant Human Actin-related protein 2/ 3 complex subunit 2 Protein, GST, E.coli-10ug

QP8442-ec-10ug 10ug
EUR 200

Recombinant Human Butyrophilin subfamily 2 member A1 Protein, His, Yeast-10ug

QP9818-ye-10ug 10ug
EUR 236

Recombinant Dog Trypsin 2/ PRSS2 Protein, His-SUMO, Invitro-E.coli-10ug

QP9996-iv-10ug 10ug
EUR 780

Recombinant Human Tryptophan 5-hydroxylase 2 Protein, His, Invitro-E.coli-10ug

QP10004-iv-10ug 10ug
EUR 462

Recombinant Human Bcl 2 (minus BH1 domain) Protein, His, E.coli-10ug

QP10491-HIS-10ug 10ug
EUR 201

Recombinant Human Bcl 2 (minus BH2 domain) Protein, His, E.coli-10ug

QP10492-HIS-10ug 10ug
EUR 201

Recombinant Human Bcl 2 (minus BH3 domain) Protein, His, E.coli-10ug

QP10493-HIS-10ug 10ug
EUR 201

Recombinant Human Bcl 2 (minus NWGR domain) Protein, His, E.coli-10ug

QP10494-HIS-10ug 10ug
EUR 201

Recombinant Rat Type-2 angiotensin II receptor Protein, GST, E.coli-10ug

QP5626-ec-10ug 10ug
EUR 272

Recombinant Rat Type-2 angiotensin II receptor Protein, His, Yeast-10ug

QP5626-ye-10ug 10ug
EUR 272

Recombinant Human AP-2 complex subunit mu Protein, His, Yeast-10ug

QP5658-ye-10ug 10ug
EUR 308

Recombinant Human Bcl-2-like protein 11 Protein, His, Yeast-10ug

QP5712-ye-10ug 10ug
EUR 236

Recombinant Pig Calpain-2 catalytic subunit Protein, His-SUMO, E.coli-10ug

QP5757-ec-10ug 10ug
EUR 326

Recombinant Human Cancer/ testis antigen 2 Protein, His-SUMO, E.coli-10ug

QP5883-ec-10ug 10ug
EUR 200

Recombinant Human Bifunctional epoxide hydrolase 2 Protein, His-SUMO, E.coli-10ug

QP5986-ec-10ug 10ug
EUR 200

Recombinant Human Eyes absent homolog 2 Protein, His-SUMO, E.coli-10ug

QP6005-ec-10ug 10ug
EUR 200

Recombinant Human Fatty acid desaturase 2 Protein, His-SUMO, E.coli-10ug

QP6016-ec-10ug 10ug
EUR 272

Recombinant Human Fos-related antigen 2 Protein, His-SUMO, E.coli-10ug

QP6053-ec-10ug 10ug
EUR 200

Recombinant Mouse LOXL2/ Lysyl oxidase homolog 2 Protein, His, E.coli-10ug

QP6317-ec-10ug 10ug
EUR 272

Recombinant Mouse LOXL2/ Lysyl oxidase homolog 2 Protein, His, Yeast-10ug

QP6317-ye-10ug 10ug
EUR 272

Recombinant Rat MMP-2/ CLG4A Protein Protein, His-SUMO, E.coli-10ug

QP6369-ec-10ug 10ug
EUR 272

Recombinant Human Myelin expression factor 2 Protein, His-SUMO, E.coli-10ug

QP6399-ec-10ug 10ug
EUR 200

Recombinant Human Arylamine N-acetyltransferase 2 Protein, His-SUMO, E.coli-10ug

QP6405-ec-10ug 10ug
EUR 272

Recombinant Human Parathyroid hormone 2 receptor Protein, His-SUMO, E.coli-10ug

QP6552-ec-10ug 10ug
EUR 200

Recombinant Mouse Serum amyloid A-2 protein Protein, His, E.coli-10ug

QP6649-ec-10ug 10ug
EUR 272

Recombinant Mouse Excitatory amino acid transporter 2 Protein, GST, E.coli-10ug

QP6691-ec-10ug 10ug
EUR 272

Recombinant Mouse Excitatory amino acid transporter 2 Protein, GST, Yeast-10ug

QP6691-ye-10ug 10ug
EUR 272

Recombinant Human Suppressor of cytokine signaling 2 Protein, GST, E.coli-10ug

QP6712-ec-10ug 10ug
EUR 272

Recombinant Human Transcription factor SOX-2 Protein, His-SUMO, E.coli-10ug

QP6718-ec-10ug 10ug
EUR 200

Recombinant Human Heat shock protein beta-2 Protein, GST, E.coli-10ug

QP7544-ec-10ug 10ug
EUR 200

Recombinant Human Oligodendrocyte transcription factor 2 Protein, His-SUMO, E.coli-10ug

QP7608-ec-10ug 10ug
EUR 200

Recombinant Human Bcl-2-like protein 15 Protein, GST, E.coli-10ug

QP7698-ec-10ug 10ug
EUR 272

Recombinant Mouse Secretoglobin family 3A member 2 Protein, His, Yeast-10ug

QP7929-ye-10ug 10ug
EUR 308

Recombinant Human Calcineurin subunit B type 2 Protein, GST, E.coli-10ug

QP8006-ec-10ug 10ug
EUR 200

Recombinant Human Ribonucleoprotein PTB-binding 2 Protein, His-SUMO, E.coli-10ug

QP8116-ec-10ug 10ug
EUR 200

Recombinant Human Transcription factor 7-like 2 Protein, His, E.coli-10ug

QP8221-ec-10ug 10ug
EUR 272

Recombinant Human ANGPTL2/ Angiopoietin-like 2 Protein, His-SUMO, E.coli-10ug

QP8238-ec-10ug 10ug
EUR 200

Recombinant Human Protein-arginine deiminase type-2 Protein, His, Yeast-10ug

QP8266-ye-10ug 10ug
EUR 236

Recombinant Human Interleukin enhancer-binding factor 2 Protein, GST, E.coli-10ug

QP8309-ec-10ug 10ug
EUR 200

Recombinant Human Inosine-5'-monophosphate dehydrogenase 2 Protein, GST, E.coli-10ug

QP8353-ec-10ug 10ug
EUR 200

Recombinant Human Proteasome subunit beta type-2 Protein, GST, E.coli-10ug

QP8364-ec-10ug 10ug
EUR 200

Recombinant Human Paired box protein Pax-2 Protein, GST, E.coli-10ug

QP8719-ec-10ug 10ug
EUR 200
Utilizing this methodology, we’ve got achieved quite a lot of mutants for the filamin A gene (7.9 kb) cloned within the pcDNA (5.four kb) or the pLV-U6-CMV-EGFP (9.four kb) plasmids, indicating that this methodology could be utilized to site-directed mutagenesis for the plasmids as much as 17.Three kb. We present that the SMLP methodology has a higher benefit than the standard strategies examined on this examine, and this methodology could be utilized to substitution, deletion, and insertion mutations for each giant and small plasmids in addition to the meeting of three fragments from PCR reactions. Altogether, the SMLP methodology is straightforward, efficient, and useful to the laboratories that require finishing the mutagenesis of huge plasmids.

Leave a Reply

Your email address will not be published. Required fields are marked *